sgRNA

about 1 month ago

I am reaching out to inquire if anyone in the community has experience using dCasRx to target exons or introns, specifically in the context of observing changes in splicing patterns. If you have worked with dCasRx in this manner, I would be grateful if you could share your insights or any relevant resources. Thank you in ad...

10 months ago

I use count_spacers.py to analyze the NGS results (paired-end). my code is as below: python countspacers.py -no-g -i sgrnainput.csv -f c_1.clean.fq my percentage of guides that matched perfectly is just 43%, and percentage of undetected guides is more than 96%: Number of perfect guide matches: 1223 Number of nonperfect...

12 months ago

I am new to the use of CRISPR libraries and I would like some input regarding a problem we are having. I am. using the GeCKO v2 library according to the Joung et al. Nature protocols paper. After library amplification we amplified the sgRNA targets by PCR using an equimolar mix of the primers foward of the paper and one of ...

about 1 year ago

Hello all I recently amplified the human GeCKO v2 and SAM libraries following the Joung et.al. 2017 protocol. I used the count_spacers.py script with a few modifications to run with phyton 3 and obtain the following statistics. GECKO-A ...

over 1 year ago

Would you share some experience about oligo annealing? I incubated the F- and R- oligoes in annealing buffer for 5mins at 95C, following by "let the oligo gradually anneal to RT". I am wondering how I should control this gradually temp drop? I have 10K F- and 10K R- oligoes, and wondering whether there is any specific ste...

over 1 year ago

I have some rather general questions. 1\. In the case of a FACS screen of differentiated cells, except from the top 10% fluorescent cells and the bottom 10% fluorescent cells (sorted control), what other samples should be included for NGS analysis? What about the plasmid DNA library and the differentiated but not sorted c...

almost 2 years ago

I am a newfie in this field. To practice before real experiment, I read the nature protocol (DOI: 10.1038/nprot.2017.016) and downloaded python code. To get the test data, I downloaded the fastq file () from the published paper (DOI: 10.1016/j.stem.2018.09.003). Here, I performed the following code: “ python ./countspacers...

almost 2 years ago

I am following your Nature protocol and have a few questions regarding the logic of the primers in Table 3 and Table 4. In Table 3, there are 10 NGS-Lib-Fwd primers, and their structure is of this: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC GACGCTCTTCCGATC TatCATGCTTAgctttatatatcttgtggaaaggacgaaacacc (NGS-Lib-Fwd-2). I le...

about 2 years ago

I'm interested in a custom CRISPR activation library using the SAM system and I have some questions: Which are the flanking sequences for the human SAM library? Are you aware of a dCas9 activity assay, as the one utilizing a GFP reporter assay for Cas9?, Which format is better to use? The 2-vector or the 3-vector sys...

about 2 years ago

Since I am not very familiar with next-generation sequence, I have a very basic question about preparation of the gDNA for NGS analysis. I was realized that "library preparation is the first step of next-generation sequencing. Once your libraries are prepared, you will be ready for the next step in your next generation seq...

dCasRx/13 and splicing

dCasRx/13 and splicing

Low match in my data using count_spacers.py

Low match in my data using count_spacers.py

poor quality of reads after library amplification

poor quality of reads after library amplification

Need help with the analysis of the sgRNA representation statistics

Need help with the analysis of the sgRNA representation statistics

oligo annealing

oligo annealing

FACS-based CRISPR screen

FACS-based CRISPR screen

How to correctly set "KEY" in count_spacers.py

How to correctly set "KEY" in count_spacers.py

primers in Table 3 and Table 4

primers in Table 3 and Table 4

CRISPR activation_SAM library

CRISPR activation_SAM library

Basic question about preparation of the gDNA for NGS analysis

Basic question about preparation of the gDNA for NGS analysis