LentiCRISPR

4 months ago

using a protocol from the broad institute, human CRISPR Brunello lentiviral pooled libraries were amplified using STBL4 cells. A gel electrophoresis image shows two adjacent bands near 14 kb (4th and 6th line), and an additional band near 1 kb which is the amp antibiotic resistance region of the plasmid . Attempting double ...

over 1 year ago

I have experiences in RNAi and Cas9 knockout experiments in mammalian cells, but am now facing a little challenge. I have primary chicken and duck endothelial cells that require knockdowns of genes - knockouts of these genes are impossible due to their importance for these cells. I have seen 1-2 papers looking at CMV/Ef1a...

about 2 years ago

We recently prepared to use SAM for screening experiments, but we found that the lentivirus titer of the package was always very low, and the cells were almost dead after adding puromycin. In addition, another CRISPRa library we used (Calabrese, from john doench lab) also had such a problem. Other lentiviruses we packaged h...

over 2 years ago

Apologies for what is probably a simple question. I'm essentially hoping to mentally generate a user guide for dCas9 () akin to the PDF for the LentiCRISPR protocol, but for the dCas9 system. Am I right that to target a gene for gain of function I should generate Lentivirus with the: lenti dCAS-VP64_Blast, Retro, Gag/Pol ...

almost 3 years ago

We try to insert sgRNAs into a Cas9 (pSpCas9(BB)-2A-Puro (PX459) V2.0) and lenticrispr-v2 vectors. Although we got a few colonies for the Cas9 vector, we cannot get for the lentivector. Any idea why? Also, I am trying to understand how the digestion of the BbsI and the sequences of the plasmid after BbsI digestion do not c...

over 3 years ago

I am trying to clone the gRNA into the LenticrisprV2 vector from addgene ( #52961). It's my fourth try and it's still a failure. No bacteria growing in my petri dishes. I am desperate because I have tried several protocols but none have worked. If someone has already managed to clone in this vector I would be indebted to h...

almost 4 years ago

It seems like the sequencing primers from Joung et al., 2017 will bind Lentiguide Puro, LentiCRISPR v2, pXPR_050 and pXPR 502. NGS-Fwd-1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTAAGTAGAG GCTTTATATATCTTGTGGAAAGGACGAAACACC NGS-KO-Rev-1 CAAGCAGAAGACGGCATACGAGATTCGCCTTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CC...

about 4 years ago

I trying to generate a KO model in ha hTERT line of fibroblast using lentiCRISPR V2 with 3 gRNA. The gRNAs are desining to generate a delection between exons 1 and 3 of my gene. I already performance puromicine selection and try to validate expresion levels of mRNA for me gene in policlonal cell line but I don't get any cha...

about 4 years ago

I am using LentiCRISPR v2 to make a point mutation in HEK293T cells. I have a few general questions: 1\. Is there a defined protocol to do HDR with LentiCRISPR v2? 2\. I transduced my HEK293T cells with the LentiCRISPR v2 cassette that had my gRNA integrated into it. I saw a specific cut on the site S421 (on the huntingti...

about 4 years ago

I am planning to do the screen using lentiCRISPR v2 library and I am designing the primers for the illumina seq.

Concerns over additional bands in CRISPR lentiviral libraries amplified using STBL4 cells

Concerns over additional bands in CRISPR lentiviral libraries amplified using STBL4 cells

Cas13 RNA design for knockdown of chicken cells

Cas13 RNA design for knockdown of chicken cells

question about SAM

question about SAM

dCas9-VP64 Lenti System

dCas9-VP64 Lenti System

Issues for getting colonies for lentiCrispr v2 vector

Issues for getting colonies for lentiCrispr v2 vector

How to clone the gRNA in LentiCRISPR V2 (Addgene #52961) ?

How to clone the gRNA in LentiCRISPR V2 (Addgene #52961) ?

Nat. Protoc. 2017 sequencing oligos for Brunello, Calabrese, & Dolcetto?

Nat. Protoc. 2017 sequencing oligos for Brunello, Calabrese, & Dolcetto?

CRISPR-CAS9 KO without reduction of mRNA (¿Continue with clons Isolation?)

CRISPR-CAS9 KO without reduction of mRNA (¿Continue with clons Isolation?)

Regarding Homology Directed Repair (HDR)

Regarding Homology Directed Repair (HDR)

illumina seq primer

illumina seq primer